Consument Study guides, Class notes & Summaries
Looking for the best study guides, study notes and summaries about Consument? On this page you'll find 395 study documents about Consument.
Popular textbooks 'Consument'
All 395 results
Sort by
-
Samenvatting MIDTERM 2 : Consument & Marketing
- Summary • 26 pages • 2024
-
- $4.92
- 6x sold
- + learn more
Dit is een samenvatting voor de tweede midterm van het vak Consument & Marketing. 
 
Deze samenvatting bevat de hoofdstukken 7 t/m 14 van het boek Consumer Behavior (8e editie), die tot de tentamenstof behoren
-
Samenvatting: Consument en Marketing (MIDTERM 1)
- Summary • 22 pages • 2024 Popular
-
- $4.92
- 5x sold
- + learn more
Dit is een samenvatting voor de eerste midterm van Consument & Marketing, waarbij de hoofdstukken 1 t/m 6 worden behandeld van het boek: Consumer Behavior, 8e editie. 
 
De samenvatting is geschreven in het Engels
-
Samenvatting Consumer Behaviour, ISBN: 9780198862567 Consument en Marketing (323623-B-6), Hoofdstuk 1 t/m 12
- Package deal • 2 items • 2023
-
- $17.57
- 10x sold
- + learn more
Samenvatting voor het vak Consument en Marketing (323623-B-6). Het bevat de hoofdstukken 1 t/m 12 uit het boek Consumer Behaviour 3rd Edition Isabelle Szmigin en Maria Piacentini. ISBN: 9780198862567.
-
MNM2605 Consumer Behaviour - Assignment 4 - MW Motors Case Study
- Essay • 12 pages • 2022
-
- $9.61
- 2x sold
- + learn more
This assignment is about the case study of MW-Motors and how they have adapted their brand to satisfy their expanding consumer base. In this assignment we discuss the process Winnie will go through to make a decision about her purchase as well as establish the different trends that develops in consumer behaviour.
-
Department of Life and Consumer Sciences Molecular Genetics
- Exam (elaborations) • 5 pages • 2022
-
- $11.99
- 1x sold
- + learn more
Question 1 [15] 
Describe and illustrate how you could differentiate between these four DNA strands, 
using DNA melting experiments: 
Strand 1: 5ʹATTTTAAATTAGCATTTAAT3ʹ 
Strand 2: 5ʹATGCCGATATTTTTAGCGCA3ʹ 
Strand 3: 5ʹAGCGGGGCGGCAGCGCGGAT3ʹ 
Strand 4: 5ʹAGCGGGGCGGCAGCGCGGATA3ʹ 
Question 2 [10] 
Your friend studying computer science is designing a new protein folding tool that will 
predict protein folding pathways. Explain to them, using your UNISA BCH3703 module 
content, why a particul...
Want to regain your expenses?
-
Consumer Behavior summary
- Summary • 71 pages • 2023
-
- $12.07
- 3x sold
- + learn more
An all encompassing summary of the course Consumer Behaviour. Written in an organized, structured way with plenty of clear examples and visuals to guide you through the learning process. 
 
This summary includes; 
* all lectures 
* all guest lectures 
* the book Nudge by Thaler and Sunstein 
* all the required readings (articles, videos, ...) 
 
This course is given by Clara Cutello en Barbara Briers at the Faculty of Business and Economics.
-
Summary Consumer Behaviour Marketing Management Erasmus University
- Summary • 53 pages • 2023
-
- $7.13
- + learn more
This is an extensive summary of the subject Consumer Behaviour at Rotterdam School of Management. It includes all notes from class and examples. I got an 8.5 with this summary.
-
AAFCS 200* - Consumer & Resource Management Questions and Answers 100% AccurateAAFCS 200* - Consumer & Resource Management Questions and Answers 100% Accurate
- Exam (elaborations) • 10 pages • 2023
-
Available in package deal
-
- $10.99
- + learn more
AAFCS 200* - Consumer & Resource Management Questions and Answers 100% AccurateAAFCS 200* - Consumer & Resource Management Questions and Answers 100% AccurateAAFCS 200* - Consumer & Resource Management Questions and Answers 100% AccurateAAFCS 200* - Consumer & Resource Management Questions and Answers 100% AccuratePensions - ANSWER-are funds paid to retired employees who paid into a pension fund while they were employed. 
 
Social Security - ANSWER--A federal program under the direction of the S...
-
AAFCS 200* - Consumer & Resource Management Exam with complete solutions
- Exam (elaborations) • 10 pages • 2023
-
Available in package deal
-
- $11.99
- + learn more
AAFCS 200* - Consumer & Resource Management Exam with complete solutions
-
Wk 3 - Apply Summative Assessment Elasticity, Consumer Choice, and Production
- Exam (elaborations) • 11 pages • 2023
-
Available in package deal
-
- $8.99
- + learn more
1. Which of the following statements is correct? 
Multiple Choice 
 Marginal utility is the sum of total utility. 
 Total utility is the sum of marginal utilities. 
 Total utility is the product of multiplying price times marginal utility. 
 Total utility is the change in marginal utility as quantity consumed increases. 
2. The tables below provide Sam's total utility for coffee and tea. 
a. Fill in the missing values for marginal utility. 
Coffee and Sam's Utility 
Cups of 
Coffee...
-
Samenvatting Marketing Communicatie Strategie
- Exam (elaborations) • 77 pages • 2023
-
- $15.49
- + learn more
Samenvatting Marketing Communicatie Strategie 
Samenvatting Marketing Communicatie Strategie 
Hoofdstuk 1: Marketingcommunicatie en andere 
marketinginstrumenten 
1.1.1 Functies van een merk voor de consument 
Een merk vervult zowel voor de consument als voor het bedrijf diverse functies. Voor de 
consumenten zijn de volgende van belang:- Gemak bij het kopenHet merk geeft de consument 
de zekerheid dat hij daadwerkelijk krijgt wat hij wil. En als dit een keer niet het geval is weet hij 
b...
-
PGA PGM LEVEL 2 Executive Management Test - Introduction to Consumer Behavior EXAM QUESTIONS AND ANSWERS.
- Exam (elaborations) • 9 pages • 2024
-
Available in package deal
-
- $12.49
- + learn more
PGA PGM LEVEL 2 Executive Management 
Test - Introduction to Consumer Behavior 
EXAM QUESTIONS AND ANSWERS.
How much did you already spend on Stuvia? Imagine there are plenty more of you out there paying for study notes, but this time YOU are the seller. Ka-ching! Discover all about earning on Stuvia